In mice with partial hepatectomy, Fas stimulation accelerates liver regeneration via FADD-independent signaling pathways (17). results support an essential role of calmodulin in mediating Fas-induced FADD-independent activation of Src-ERK signaling pathways, which promote survival signaling in pancreatic cancer cells. Understanding the molecular mechanisms responsible for the resistance of pancreatic cells to apoptosis induced by Fas-death receptor signaling may provide molecular insights into designing novel therapies to treat pancreatic tumors. for 15 min at 4 C, the supernatant was immunoprecipitated with 40 l of goat anti-mouse IgM-agarose (Sigma) overnight at 4 C and analyzed by Western blotting. Expression and Purification of Fusion Proteins in Escherichia coli The human Src cDNA from pDONR223-Src (Addgene, Cambridge, MA) was cloned into pcDNA3.1 (Invitrogen) or pCMV-Tag2A (Stratagene, La Jolla, CA) and confirmed by sequencing. The QuikChange site-directed mutagenesis kit (Stratagene) was used to make Src mutations. The primers for making mutation are as follows: SRC mutation forward, GGGCCTCAACGTGGCGGCTGCAGCGGCTGCCGCAGCGGCTGCCGGCGGCTTCTACATCACCTCC, and SRC mutation reverse, GGTGATGTAGAAGCCGCCGGCAGCGCTGCGGCAGCCGCTGCAGCCGCCACGTTGAGGCCCTTGGCGTTG. Expression and purification of GST proteins were performed as described previously (15). GST proteins were expressed in test. Significance was defined as 0.05. RESULTS FADD Knockdown Attenuates Fas-induced Apoptosis in Pancreatic Cancer Cells We analyzed the expression of Fas receptor in several pancreatic cells and identified that the expression of Fas is usually higher in pancreatic cancer cell lines MiaPaCa-2 and BxPC-3 compared with that in ASPC-1 and PANC-1 cells. Consistently, low expression of Fas by ASPC-1 and PANC-1 cells renders them resistant to Fas-induced apoptosis (data not shown). Therefore, to further understand Fas-activated signaling pathways in pancreatic cells, we utilized the pancreatic cancer cells expressing higher levels of Fas, MiaPaCa-2 and BxPC-3 cells. The expression of the Fas receptor was comparable in MiaPaCa-2 and BxPC-3 cells. Upon stimulation, the death receptor Fas recruits adaptor protein FADD, which binds to caspase-8 or FLIP to activate apoptotic or survival signaling pathways. In addition, Fas has been shown to induce cell survival/proliferation impartial of FADD (17, 32). To determine (-)-Indolactam V whether FADD is required for Fas-activated apoptotic or proliferative signals in pancreatic cancer cells, we generated MiaPaCa-2 and BxPC-3 cells with FADD knockdown using lentivirus-delivered shRNA that specifically targets FADD. Western blot analysis confirmed the knockdown of FADD in these cells (Fig. 1shown are Western blot analyses of the expression of FADD in these cells. The expression of GAPDH was used as a (-)-Indolactam V loading control. The results represent means S.D. from three impartial experiments. 0.05 compared with control group. FADD Knockdown (-)-Indolactam V Renders Increased Cell Survival via ERK Activation in Response to Fas Stimulation To determine whether FADD is required for Fas-induced survival signaling pathways, we decided the effect of Fas stimulation on the survival of FADD knockdown cells. The Fas agonist antibody CH-11 was found to increase accumulation of FADD knockdown cells in a concentration-dependent manner (Fig. 2 0.05 compared with control group. Fas-activated Src Phosphorylation Regulates ERK Activation in FADD Knockdown Cells To investigate the molecular mechanisms of ERK activation upon Fas stimulation, we determined the effect of Rabbit polyclonal to beta Catenin CH-11 around the activation of Src kinase, which has been demonstrated to regulate Fas death receptor signaling in colon cancer and glioblastoma tumorigenesis and metastasis experiments (36, 37). Increased activation of Src, as exhibited by its phosphorylation, was exhibited in FADD knockdown cells in (-)-Indolactam V response to CH-11 in a time-dependent manner. The Fas-induced activation of Src activation was blocked by the Src inhibitor, PP2, which also (-)-Indolactam V decreased the Fas-induced activation of ERK (Fig. 3 0.05 compared with control group..
Recent Posts
- Even though most disease is native to the island, these same elements give typhoid a high pandemic potential, and outbreaks take place periodically, which includes outbreaks brought on by antimicrobial drugresistant strains (2124)
- UBC-Cre/ERT2
- Highs identified simply by Probes you and two listed individually in bed linens 1 and 2, correspondingly
- Therefore , we hypothesized that small-molecule PPI modulators between LRS and RagD can be used because powerful study tools intended for studying the nutrient-dependent activation of mTORC1 and the subsequent biological results
- In addition , RAGE offers a functional platform for the crosstalk with other receptors
Recent Comments