B Confocal localization of actin ( em red /em ), otoferlin (HCS-1 antibody, em green /em ), and PMCAb ( em blue /em ) in an isolated saccular hair cell by confocal microscopy. otoferlin is usually tightly associated with membranes, as it is not solubilized by alterations in calcium or salt concentrations. HCS-1 immunolabeling does not co-localize with ribeye, a constituent of synaptic ribbons, suggesting that otoferlin may, in addition to its proposed function in synaptic vesicle release, play additional roles in hair cells. XL1 blue cells (Stratagene), recombinant plasmids were identified by PCR and by restriction enzyme digestion of plasmid DNA. One plasmid was selected for use in the second cloning step, linearized with BamHI, and dephosphorylated. The 3 half of the cDNA was amplified as above, using primers GgOtofF7 (GTGGCCTTTCgGATCCCTTTG, including point mutation A G at base 11 to create a BamHI site, underlined) and GgOtofR4 (CCGGTGGATCCCTATGCCCCCAGGAGCTTCTTGAC, BamHI site underlined). The PCR product was gel-purified, cut with BamHI, and ligated into the prepared plasmid. After transformation into XL1 Blue, full-length otoferlin clones were identified by PCR and restriction enzyme digests of plasmid DNA. Clone pOtofFL5 BML-284 (Wnt agonist 1) was sequenced BML-284 (Wnt agonist 1) fully to confirm that this insert encoded full-length otoferlin. pOtofFL5 was transfected into cells using Lipofectamine 2000. After overnight incubation, cell monolayers were fixed in 3.7% formaldehyde in 0.1?M sodium phosphate buffer, pH?7.5, blocked in TBS containing 10% horse serum and 0.1% TX100 for 1?h, and then incubated overnight with HCS-1 mAb diluted 1 in 500 in TBS plus 10% horse serum. After washing three times in TBS, Alexa 555 conjugated goat anti-mouse IgG2a (1 in 500 in TBS/HS) was added for 1?h, and monolayers were Rabbit Polyclonal to SCAND1 washed three times in TBS, mounted with Vectashield, and photographed on a Zeiss Axioplan fluorescence microscope or a Zeiss LSM510 confocal microscope. Three overlapping fragments of otoferlin were amplified by PCR with Pfu polymerase (Stratagene) using cDNA from P2 chicken utricle as the template. Products obtained with primer pairs GgOtofF1 (CAGATCTCGAGCTATGGCTCTGCAGCTGCAGCT, XhoI) and GgOtofR1 (CCGGTGGATCCCTAGGGCAGGTAGCCTTTGTCTC, BamHI), GgOtofF2 (CAGATCTCGAGCTCAGTGGGCTCGTTTCTACATC, XhoI) and BML-284 (Wnt agonist 1) GgOtofR2 (CCGGTGGAT CCCTACTGGTAGTATTCCAGCTGTG, BamHI), and GgOtofF3 (CAGATCTCGAGCTTTCCAGCTGCGAGCCCACATG, XhoI) and GgOtofR4 (CCGGTGGATCCCTATGCCCCCAGGAGCTTCTTGAC, BamHI) were gel-purified, digested with XhoI and BamHI, and ligated into XhoI and BamHI cut pEGFP-actin (Clontech). PCR and restriction digests of plasmid DNA were used to identify clones encoding EGFP-otoferlin fusion proteins. All BML-284 (Wnt agonist 1) inserts were confirmed to be free of errors by DNA sequencing. All three constructs expressed EGFP-tagged protein in mammalian cells that was not recognized by the HCS-1 mAb, possibly as a result of misfolding caused by the tag (data not shown). RT-PCR Total RNA from 1?day post-hatch chick tissues was isolated using Trizol (Invitrogen, Paisley, UK) then treated with RNase-free DNase I to remove traces of genomic DNA (Applied Biosystems, Warrington, UK). Randomly primed first-strand cDNA was synthesized from 1?g of total RNA using AMV reverse transcriptase (Promega, Southampton, UK) and the reaction diluted to 100?l final volume. Otoferlin and GAPDH PCR products were amplified from 2?l aliquots of the reverse transcriptase (RT) reactions using Bioline Taq polymerase (Bioline, UK) and primers GgOtofF3 and GgOtofR2 (see above) and GAPDHF1 (GCTGAGTATGTTGTGGAGTC) and GAPDHR1 (TCAGCAGCAGCCTTCACTAC). Aliquots (5?l) of the PCR reactions were run on 1.5% agarose gels, stained with ethidium bromide, and photographed under UV illumination. Results Isolation and characterization of hair cell soma-1 antibody As a means to identify and characterize proteins important for inner ear function, we immunized mice with emulsified chicken inner ear sensory epithelia that had been briefly exposed to a dilute aldehyde fixative. We generated a panel of 400 wells made up of hybridoma cells. Supernatants from these wells were initially screened by ELISA on a chicken inner ear homogenate. Cells from the wells that gave a positive signal by ELISA were subsequently expanded and screened by immunohistochemistry on frozen sections of chicken utricles. Using this approach, 40 antibodies were isolated that recognized proteins in specific cell types of the inner ear. Of these, four antibodies were further characterized: two IgG2b antibodies bound specifically to supporting cells (data not shown), one IgM antibody bound to the cuticular plate of the hair cell (data not shown), and one IgG2a antibody bound to an antigen specifically found in the hair cell soma. This latter antibody was named the HCS-1 antibody. The.
Recent Posts
- Only the highly S100-positive EGC also expressed the TLR2 (Figure5B), but no changes were observed after LPS stimulation
- (B) or i
- Upon binding with the mark mRNA, the flare sequences discharge in the ssDNA strands and offer a detectable cue in the cancerous cells
- This is reflected that HER2 overexpression is correlated with an increase of threat of death, shortened disease progression-free survival and overall survival rate in patients [17,18]
- RECIST was also significantly from the percentage of residual tumor cells: median beliefs were 70% (IQR, 65%70%), 50% (IQR, 20%70%), and 30% (IQR, 10%60%) in sufferers with progressive disease, steady disease, and partial response, respectively (P=
Recent Comments